Warning (2): rename(/var/www/logs/error.log,/var/www/logs/error.log.1788374466): No such file or directory [CORE/src/Log/Engine/FileLog.php, line 206]
RCPedia: Rtcs

Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL36AP2
Plot displaying the genomic locations of a retrocopy (in scaffold_m13_p_1) and its respective parental gene (in scaffold_m13_p_9). Each line represents a retrocopy.
Species Rousettus aegyptiacus
Coordinates scaffold_m13_p_1:144400574-144400879  UCSC
Strand +
Parental Sequence RPL36A_x1
Parental seq. overlap 258 bp
Parental seq. overlap (%) 59.4%
Genomic Region Intragenic (AFG1L)
Retrocopy Summary RPL36AP2, located on scaffold_m13_p_1:144400574-144400879, is a retrocopy of the parental gene RPL36A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL36A
Full Name N/A
Also known as NULL
Coordinate scaffold_m13_p_9:59049814-59052432
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Sheep Ovis aries RPL36AP7
Horse Equus caballus RPL36AP5
Pale spear-nosed bat Phyllostomus discolor RPL36AP25
Greater horseshoe bat Rhinolophus ferrumequinum RPL36AP10
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Dolphin Tursiops truncatus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL36AP2
TGTTCCTAAAACCTGCTGGACTTCCTGTAAGAAGTGTGGCAAGCACTAAATCCCAAAAGTGACACAGGACGAGAAGGGCAAGGAATCTTCATATGTCCAGGGAAAGCTGCCTTATGATGGGGAACAGAGAGACTGGGCTGGGCTGACTAAACCATTTTTCTGGAAAAAGGCTAAAACCACAAAGGAGATTGTGCTTGAATGCAGTGAGCCCAACTGCAGATCTAGAGATTGTTAGCCATTAAAACATGGAAGCATTTTGAACAAGGAAGAGATAAGAAGAGAAAGGGCCAAGTGATTCAGTTCTAA
>RPL36A_x1
ATGGTCTCTCCTACCGACTCCCACGAGGAAGAGCAACTAGGAACCTCCTACATACTTCCGTTTCCGGACCTGCCTCTTTCTTTCTCTGCTGGTAGTGATCTCGCTAACATGGTGAACGTTCCTAAAACCCGCCGGACTTTCTGTAAGAAGTGTGGCAAGCACCAACCCCACAAAGTGACACAGTACAAGAAGGGCAAAGACTCTCTGTATGCGCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGTTATGGTGGGCAGACTAAGCCGATTTTCCGCAAAAAGGCTAAAACTACAAAGAAGATTGTCCTGAGGCTTGAATGCGTTGAGCCCAACTGCAGATCTAAGAGAATGCTGGCTATTAAGAGATGCAAGCATTTTGAACTGGGAGGAGATAAGAAGAGAAAGGGCCAAGTGATCCAGTTCTAA

Publications

PMID - Link Title